(a.) Having color; -- usually in composition; as, bright-hued; many-hued.
Example Sentences:
(1) We have previously shown that about 90% of total Escherichia coli lac repressor synthesized in mammalian cells is located in the cytoplasm [Hu and Davidson, Cell 48 (1987) 555-566].
(2) Our dynamic study indicated that: 1) a bolus injection of contrast medium with our method of CTA (CTA-B) produced an attenuation difference between liver and tumor which was about double that obtained with standard methods for CTA, and 2) marked tumor-liver attenuation differences (above 20 HU) persisted for more than 60 s in CTA-B and for not more than 20 s with conventional methods for CTA.
(3) The protein sequence of the homoeo domain is identical to that encoded by Hu-1, one of a the pair of closely linked homoeo boxes in the human genome.
(4) He looks set to become a stronger leader than his cautious predecessor, Hu Jintao, but he is no radical reformer, experts say.
(5) Moreover, Anti-Hu+ nonneuronal cells are transient and appear to be replaced by Anti-Hu+ neuronal cells.
(6) We conclude that sonography is extremely useful as a noninvasive procedure in evaluating the occasional small renal mass with CT number greater than 20 HU.
(7) Suppression of the cell cycle progress rate by HU was further enhanced by the combination of a low concentration of TdR and HU as compared to that induced by TdR alone; i.e., these drugs were shown to have a synergistic effect.
(8) Using SE as superantigens in SCID-hu mice, we have been able to induce antigen-specific clonal deletions, anergy, and proliferation of human T cells.
(9) We will get you out!’ We must fight for her freedom,” Hu added.
(10) The US president is under pressure to show he can deliver on his promises to reduce America's greenhouse gas emissions — especially as China's president, Hu Jintao, is expected to announce a new climate initiative at the summit.
(11) Hu Ping, a US-based editor and friend of Liu, asked why the international community was not doing more to secure his release.
(12) The anointed heir, Xi Jinping , commanded less attention than former general secretary Jiang Zemin, seated next to current leader Hu Jintao.
(13) CsA inhibited dose-dependently the EBV-induced Hu IFN-gamma response, studied at the cellular level in human blood lymphocytes.
(14) The presence of Fe++ blocked completely the cytotoxic action of HU alone and a combination with iron-chelator, and partially reversed the inhibition induced by HU and bipyridyl.
(15) We have defined the optimal circumstances for the induction of human interferon alpha (Hu IFN alpha) in peripheral blood mononuclear cells (PBMC) using complexed polyinosinic-polycytidylic acids (poly rIrC).
(16) Initial alterations in fetal hemoglobin (HbF) production among eight sickle cell anemia subjects treated with hydroxyurea (Hu) are summarized.
(17) Binding specificity of histone-like HU alpha protein to supercoiled DNA was examined by gel retardation assay and chemical probing with OsO4.
(18) In vivo and in vitro 'suicide' assays of spleen cells indicated that cells were stimulated by the HU or the initial stimulus to enter into DNA synthesis shortly after stimulation.
(19) The G1-S blockade was rapidly reversed in the liver after the end of HU infusion.
(20) Since the estimation of erythropoietin (EPO) by radioimmunoassay (RIA) has been limited by the availability of highly purified urinary (U) human (Hu) EPO, we investigated the use of recombinant (R)-HuEPO as a replacement for U-HuEPO in the preparation of 125I-tracer and high affinity antisera.
Pued
Definition:
(imp. & p. p.) of Pue
Example Sentences:
(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.