(a.) Uttered in one unvarying tone; continued with dull uniformity; characterized by monotony; without change or variety; wearisome.
Example Sentences:
(1) Increasing concentrations of cholesterol monotonically increase the dipole potential of egg phosphatidylcholine monolayers, from 415 mV with no cholesterol to 493 mV with equimolar cholesterol.
(2) "Weak" subjects tended to fall asleep more rapidly during monotonous stimulation, whereas the reverse was true of "strong" subjects.
(3) Although their increases were monotonic in a given heart, their sensitivities to catecholamines were considerably variable among hearts.
(4) For an "FM specialized" cell, the response pattern to each of the parameters was either monotonic or bell-shaped.
(5) The extent of Ca2+ uptake was monotonically increased as the pH increased from 6 to 9.
(6) Serum apolipoprotein A-I concentrations were unaltered, apolipoprotein A-II underwent a transient increase, and apolipoprotein B increased monotonically during parenteral nutrition.
(7) Critical features of the model include a non-monotonic relationship between recovery time during rhythmic stimulation and the state of membrane properties, and a steeply sloped recovery of membrane properties over certain ranges of recovery times.
(8) As subcritical crack velocities under cyclic loading were found to be many orders of magnitude faster than those measured under equivalent monotonic loads and to occur at typically 45% lower stress-intensity levels, cyclic fatigue in pyrolytic carbon-coated graphite is reasoned to be a vital consideration in the design and life-prediction procedures of prosthetic devices manufactured from this material.
(9) Pulsed-field electrophoresis experiments resulting in the establishment of an electrophoretic karyotype for yeast, where the mobility of the DNA fragments is a monotonic function of molecular size for the entire size range that is resolved (200-2200 kilobase pairs), has been compared to the theoretical mobility curves generated by the computer model.
(10) Input-output functions at inhibitory frequencies were nonmonotonic, while they were always monotonic at best frequencies near CF.
(11) Other consequences of increasing gNa+max were a decrease in the minimum sustainable rhythmic firing frequency (mRFF), a monotonic increase in firing frequency at any given suprathreshold stimulus intensity, an increase in the current value at which intense depolarizing stimuli block rhythmogenesis, an increase in the maximal sustainable firing frequency using intense currents (MRFF), and the consequent expansion of the dynamic range for stimulus encoding.
(12) The voltage dependences of the ON and OFF charges measured with these pulses were clearly different: QON had a maximum at or slightly above the contraction threshold, while QOFF increased monotonically in the voltage range examined.
(13) FNA smears from a lymph node in a patient with a previous histological diagnosis of lymphomatoid papulosis of the gingiva showed a monotonous pattern of large immunoblastic cells with some binucleated variants consistent with a diagnosis of high grade immunoblastic lymphoma, which was confirmed histologically.
(14) It is a monotonous, unreactive and anteriorly predominant activity of less than 50 microV and of 8 to 13 Hz.
(15) Several temporal principles that govern multisensory integration were revealed: (1) maximal levels of response enhancement were generated by overlapping the peak discharge periods evoked by each modality; (2) the magnitude of this enhancement decayed monotonically to zero as the peak discharge periods became progressively more temporally disparate; (3) with further increases in temporal disparity, the same stimulus combinations that previously produced enhancement could often produce depression; and (4) these kinds of interactions could frequently be predicted from the discharge trains initiated by each stimulus alone.
(16) Monotonic decreases in ambulation after tetrabenazine were not significantly affected in the rubidium-treated animals though the decreases were sometimes preceded by slight increases and recovery from the decrement tended to be more rapid.
(17) To estimate mechanical characteristics of such membranes, it is necessary to carry out the noncontact pressure test and membranous contact test, in addition to the usual monotonic tensile test, by using a rectangular specimen cut from the membranes.
(18) In cell-attached recordings the high-frequency component declined monotonically with increasing light intensity, suggesting that less than one-half of the channels are open in darkness.
(19) The strength of this genetic control, however, systematically diminished throughout the course of practice obeying a monotonic trend over trials.
(20) The open time had a monotonic mole fraction relationship in mixtures of Li+ and K+.
Repetitious
Definition:
(a.) Repeating; containing repetition.
Example Sentences:
(1) Such ordering projects involve a large investment of effort involving many repetitious experiments.
(2) The repetitious tet element is itself part of a 7.2 Mdal-transposon, named Tn1721, as demonstrated by the following criteria; (i) Tn1721 has been translocated to phage lambda.
(3) The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T).
(4) Over-all, written repetitiousness was more strongly correlated with psychopathologic features than oral repetitiousness.
(5) Dentists in developed countries tend to provide highly restoration-oriented dental care, yet recent research has shown that restorations have many shortcomings and that a costly and repetitious restorative cycle is easily established.
(6) The program interacts with other software in the hospital, avoiding repetitious entries.
(7) Repetitious DNA fractions were obtained at C0t 0-0.01.
(8) "Extremely severe" and repetitious gross oral movements (around 1 Hz) were observed within a few minutes after injection and continued for up to 1 h. Thereafter, oral movements tended to decrease, and they disappeared completely 3 weeks after injection.
(9) While the method should be applicable to a number of repetitious DNA sequences, we have used the polypyrimidine DNA sequences (TCTCT)n to develop this technique.
(10) A model of 12 laboratory tests was found to be more appropriate for studying recognition and follow-up than one of 30 because of fewer repetitious tests and fewer results of doubtful clinical usefulness.
(11) In contrast to these gene families, sequences complementary to an internally repetitious Echinus DNA clone were found primarily in the methylated DNA compartment.
(12) The sequence that codes for the gly-ala repetitious peptide characteristic of fibroin begins somewhere between 1340 and 1600 bp from the 5' end.
(13) Repetitious sequences are found in DNA components of all base compositions but the (G + C)-rich sequences are enriched for repetitive sequences in (A + T)-rich components are tandemly arranged; those in (G + C)-rich components tend to be interspersed with single copy sequences.
(14) 300-400 bp) contains short direct repeats, otherwise dh is in general internally non-repetitious.
(15) We suppose that the repetitious nonhomologies generate DNA configurations sufficient to disrupt the effective synapsis over the entire locus.
(16) The renaturation kinetics of labeled DNA derived from synchronized Chinese hamster cells indicate that the three classes of repetitious DNA replicate uniformly throughout the S period, and that a piece of repetitious DNA may occur at or near the beginning of each replicon.
(17) Ten length variants were cloned, including alleles at each of the four PRB loci, and in every case the region of length difference was localized to the tandemly repetitious third exon.
(18) The middle repetitious DNA sequences are thought to be related in these two DNA families.
(19) In situ hybridization of BR 2 RNA to the polytene chromosomes of each individual species, as well as their F1 hybrids, reveals that the repetitious BR 2 DNA in the two species has, within the limits of the technique, retained identity of nucleotide sequences and degree of repetition.
(20) Arthroscopy in each case failed to demonstrate the anticipated loose body but did demonstrate a fibrotic synovial fringe that impinged between the radial head and the capitellum on repetitious elbow flexion and extension, particularly with the forearm in pronation.