(1) Qa-2 antigen expression was used as a marker for the Q subregion and fast or slow development was used to assess Ped gene phenotype in backcross embryos generated from the mating of (B6.K1 x B6.K2)F1 and B6.K1 mice.
(2) We recently studied the effects of 4-OHA and other aromatase inhibitors, 10-propargylestr-4-ene-3,17-dione (PED) and imidazo[1,5-alpha]3,4,5,6-tetrahydropyrin-6-yl-(4-benzonitrile) (CGS 16949A) as well as 5 alpha-reductase inhibitors, N,N-diethyl-4-methyl-3-oxo-4-aza-5 alpha-androstane-17 beta-carboxyamide (4-MA) and 17 beta-hydroxy-4-aza-4-methyl-19norandrost-5-en-3-one (L651190) in prostatic tissue from 11 patients with prostatic cancer and six patients with benign prostatic hypertrophy (BPH), and from normal men at autopsy.
(3) A simple, accurate, and practical device was designed for detecting the woman at risk for postpartum emotional disorder (PED).
(4) Hedo Turkoglu was busted for PED use Despite the fact that the use of performance enhancing drugs is one of the biggest stories in sports today, alongside other notable topics such as imaginary girlfriends and ill-timed power failures, the NBA world seems strangely immune to the controversy.
(5) PEDS Plus broth aids diagnosis of pediatric bacteremia by increasing recovery of etiologic agents and decreasing the time required for detection.
(6) The results of these studies show that the difference in the rate of cleavage division between slow-developing strains (Ped slow) and fast-developing strains (Ped fast) is maintained in vitro.
(7) Initial detection occurred earlier with Bactec Peds Plus, while growth on solid media occurred earlier with Roche Septi-Chek.
(8) Of 7,798 adult patients admitted to a level I trauma center from July 1986 through June 1990, 16.0% (1,246) had greater than or equal to 1 PED.
(9) It appeared on the border of the PED (16 cases) usually temporally, or on the immediate border of the laser scar (4 cases).
(10) The findings, corrobated with other closely comparable observations, suggest that the emergence of PED as an intercurrent mortality problem during rabbit passage of pathogenic Treponema pallidum is the result of a specific selective pressure on a benign passenger virus.
(11) However, the results also demonstrate that several of the PDE inhibitors have effects on central DA mechanisms that are difficult to explain solely on the basis of PED inhibition.
(12) 9.56pm BST More Guardian coverage My colleague Michael Solomon weighs in with a piece that explains the Biogenesis PEDs scandal.
(13) Medium levels of progesterone, a major product of these cells, were found to decrease in a dose- and time-dependent manner upon addition of PED.
(14) PED was elicited either mechanically by employing single or double pressure steps, or electrically by antidromic stimulation of the aortic nerve.
(15) One hundred eighty-one isolates were recovered in both bottles, 75 in PEDS Plus only, and 33 in 6A only (P less than 0.001).
(16) Obvious subretinal new vessels developed in 16 (34%) of the serous PEDs over an average follow-up period of 25 months.
(17) Similarly, neither the position nor curvature of the Ped-Aed relation was changed by ULFS-49.
(18) This is a sign that although MLB and MLBPA are now working together to rid PED's from the game, the union is still prepared to fight for due process which makes a lot of sense from their perspective.
(19) The slow potassium current (Er = -85 mV) evoked in Ped-8 and Ped-9 neurones by glutamate, quisqualate and kainate could be blocked by tetraethylammonium (50 microM).
(20) Meanwhile Bud Selig, who made his pursuit and punishment of those using PEDs a top priority during a controversial, costly and aggressive investigation, is reaching the end of his time as MLB commissioner.
Pued
Definition:
(imp. & p. p.) of Pue
Example Sentences:
(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.