What's the difference between pied and pued?

Pied


Definition:

  • (imp. & p. p.) of Pi
  • () imp. & p. p. of Pi, or Pie, v.
  • (a.) Variegated with spots of different colors; party-colored; spotted; piebald.

Example Sentences:

  • (1) Other Christmas favourites, including stollen, organic mince pies and Schweppes tonic will also be included among 100 seasonal products on the list of 1,000 items which shoppers can choose from over the next few months.
  • (2) Paul Doyle Kick-off Sunday midday Venue St Mary’s Stadium Last season Southampton 2 Leicester City 2 Live Sky Sports 1 Referee Michael Oliver This season G 18, Y 60, R 1, 3.44 cards per game Odds H 5-6 A 4-1 D 5-2 Southampton Subs from Taylor, Martina, Stephens, Davis, Rodriguez, Sims, Ward-Prowse Doubtful Bertrand, Davis, Van Dijk (all match fitness) Injured Boufal (knee, Jan), Hesketh (ankle, Feb), Targett (hamstring, Feb), Austin (shoulder, Mar), Pied (knee, Jun), Gardos (knee, unknown) Suspended None Form DWLLLL Discipline Y37 R2 Leading scorer Austin 6 Leicester City Subs from Zieler, Hamer, Wasilewski, Gray, Fuchs, James, Okazaki, Hernández, Kapustka, King Doubtful None Injured None Suspended None Unavailable Amartey, Mahrez, Slimani (Africa Cup of Nations) Form LDLWDL Discipline Y44 R1 Leading scorers Slimani, Vardy 5
  • (3) This technique is compared with calculated outline and ring source attenuation correction techniques in a pie phantom.
  • (4) We describe a premature infant with progressive worsening of unilateral PIE, which was successfully treated by selective bronchial balloon catheterization after failure of conservative management.
  • (5) Studied were the composition and the technologic properties of the milk of Dutch Black pied cattle under this country's conditions.
  • (6) Superfusion with 10(-6) to 10(-4) M arachidonic acid resulted in a slow developing positive inotropic effect (PIE) in a concentration-dependent manner.
  • (7) The 2 Fat Butchers in Walmer offers high-quality free-range meat and excellent pork pies and scotch eggs.
  • (8) A Staphylococcus strain was inoculated on the top and cut surfaces of freshly baked Southern custard pies which were then packaged in a pasteboard carton and held at 30 C. Daily plate counts of surface sections 0.3 inch (0.76 cm) in thickness were made.
  • (9) She almost wills her biscuits to dry out and her pies to sink.
  • (10) Facebook Twitter Pinterest The big difference is that I’ve got my finger in all the pies, whereas Lord Farquaad only thought he did.
  • (11) A total of 33 strains of staphylococci, isolated from Black Pied cows with subclinical mastitis (conformed by the brom-thymol test), were studied to establish their biochemical properties and resistance to antibiotics as well as the occasional correlation between enzyme activity and resistance.
  • (12) An increase in eosinophils carrying surface IgE was demonstrated in alveolar cells from PIE Syndrome particularly with hypodense eosinophils from CEP patients.
  • (13) The appearance of PIE and its complications, i.e., pneumothorax and pneumomediastinum, occurred over a wide range of mean airway pressures and positive end-expiratory pressures; there was no direct relationship between barotrauma and mean airway pressure or positive end-expiratory pressure.
  • (14) MCI-154 (10(-7) to 10(-4) M) produced a concentration-dependent PIE amounting to 75% of the maximal effect of isoproterenol.
  • (15) The killer's taste in movies stretches from westerns to gangster thrillers to Elvis Presley musicals: apple-pie imports that were boycotted by socialist president Sukarno's coalition before the coup.
  • (16) A case of PIE syndrome induced by Saiboku-To (TJ96) is reported.
  • (17) She had a history of PIE syndrome induced by disodium cromoglycate 4 years previously (Jpn.
  • (18) It will be streamed live here: Monetary Policy Committee August 2013 Inflation Report My colleague Andrew Sparrow will be live-blogging the whole session here: Mark Carney gives evidence to the Commons Treasury committee: Politics live blog 9.52am BST This graphic shows how most of the Royal Mail's revenues come from its parcels and letters divisions, although its European parcels business, GLS, makes a decent contribution (with revenue of £1.5m, out of a total pie of over £9bn.
  • (19) Safdie himself still maintains a pied-à-terre in the 13-storey building, which stands on a narrow, man-made peninsula just south of the Old Port section of Montreal.
  • (20) I got it wrong on PIE and I apologise for having done so.

Pued


Definition:

  • (imp. & p. p.) of Pue

Example Sentences:

  • (1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
  • (2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
  • (3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
  • (4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
  • (5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
  • (6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
  • (7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
  • (8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
  • (9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
  • (10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
  • (11) Inhalation was the primary mode of the Pu exposures.
  • (12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
  • (13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
  • (14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
  • (15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
  • (16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
  • (17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
  • (18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
  • (19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
  • (20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.

Words possibly related to "pued"