(1) Following the surgery, one patient continued to exhibit PLEDs but clinical seizures were absent PLEDs recurred in the second patient due to inadequate anticonvulsant medication.
(2) The third pleiotropic gene, pleD, is described here for the first time.
(3) Neck stiffness and cerebrospinal fluid findings were improved and PLEDs disappeared.
(4) This is in contrast to the normal outcome for 8 of the 11 infants who did not have PLEDs.
(5) The electrographic characteristics of PLEDs in these infants were similar to those reported in neonatal herpes simplex encephalitis and in older children and adults.
(6) Although a great deal of attention has been directed to the neuropathological basis of PLEDs, little emphasis has been placed on the functional basis of this EEG syndrome.
(7) Over 100 film industry insiders signed a letter in support of Roman Polanski , who pled guilty to "unlawful sex" with a 13-year-old.
(8) A 74-year-old woman reveal typical periodic lateralized epileptiform discharges (PLED's) on the right hemisphere.
(9) Three patients are described with pathologically verified Creutzfeldt-Jakob disease (CJD) who presented with localizing clinical signs accompanied by focal electroencephalographic abnormalities including periodic lateralized epileptiform discharges (PLEDS).
(10) Although PLEDs are usually seen in association with an acute or subacute disturbance of cerebral function, the findings in this group of patients show that chronic PLEDs also can occur in patients with long-standing seizure disorders or chronic brain lesions.
(11) Ischemic strokes associated with PLEDs have some characteristic features: old age, vascular risk factors, parieto-occipital areas infarcts and frequent association with TIAs.
(12) PLEDs was found in acute dysfunction of CNS, and in epileptic patients in periods of increased seizure activity.
(13) All episodes were accompanied by the occurrence of periodic lateralized epileptiform discharges (PLEDs) on the EEG, which became normal when the ictal episodes subsided either spontaneously or after administration of diazepam i.v.
(14) EEG obtained on the fourth hospital day showed right-sided PLEDS and on the fifth hospital day a generalized seizure occurred.
(15) She later showed periodic lateralized epileptiform discharges (PLEDs), originating in the left hemisphere, which were temporally associated with nystagmus retractorius.
(16) Low amplitude rhythmic discharges (RDs) closely associated in time and in spatial distribution to inter-ictal epileptiform discharges are not seen in scalp EEGs of patients with non-periodic focal epileptiform discharges (NPEDs) but they are unexpectedly common in patients with periodic lateralized epileptiform discharges (PLEDs).
(17) We postulate that the EEG phenomenon of PLEDs could be considered a part of the status epilepticus condition.
(18) But Senate minority leader Harry Reid pled for action on the Senate floor on Tuesday.
(19) A retrospective study was carried out in 147 patients who had been found to have periodic lateralized epileptiform discharges (PLEDs).
(20) Our case is significant for the following reasons: 1) PLEDs maximal right and left occipital areas associated with bilateral visual loss has not previously been observed; 2) abnormal electrical activity in the occipital lobes may be a reversible cause of Anton's syndrome.
Pued
Definition:
(imp. & p. p.) of Pue
Example Sentences:
(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.