(1) Research is needed regarding the correlates of PUD in Ss with well-controlled IDDM of relatively brief duration.
(2) Refrigerate for at least four hours until the pudding feels firm to the touch.
(3) Recently awarded best veggie blog by Vegetarian Living, her stuffed naan breads and toffee apple and peanut pudding are definitely on the to-eat list.
(4) A former Socialist party leader, he is a jovial, wise-cracking believer in consensus politics, who aides say never loses his rag and who so hates fights that he was once nicknamed "the marshmallow" within his own party, or "Flanby", after a wobbly caramel pudding.
(5) Even the nickname given to him of Monsieur Flanby, after a caramel pudding, over his perceived wobbly political views, lost its relevance as he elaborated his programme.
(6) Asked about his forthcoming Christmas television special in an interview in the Radio Times, the BBC presenter, who turns 90 next year, said: “At Christmas we’re under the impression we have it all: we have turkey and brandy butter and Christmas pudding and the family and we have a great time, by and large.
(7) It is the England that then prime minister John Major vowed would never vanish in a famous 1993 speech: “Long shadows on county grounds, warm beer, invincible green suburbs, dog lovers and pools fillers and – as George Orwell said – ‘old maids bicycling to holy communion through the morning mist’.” Major was mining Orwell’s wartime essay The Lion and the Unicorn, whose tone was one of reassurance – the national culture will survive, despite everything: “The gentleness, the hypocrisy, the thoughtlessness, the reverence for law and the hatred of uniforms will remain, along with the suet puddings and the misty skies.” Orwell and Major were both asserting the strength of a national culture at times when Britishness – for both men basically Englishness – was felt to be under threat from outside dangers (war, integration into Europe).
(8) And he would suggest having it as a pudding, in winter, with a dollop of custard.
(9) Google celebrates the Mayan calendar in today's doodle Updated at 1.10pm GMT 9.46am GMT How to destroy the Earth In part two of our apocalypse video series, I demonstrate how the world could end using a variety of household props, including a Christmas pudding, a blow torch, some pebbles from my garden and a miniature snooker table.
(10) Fifteen % of the endoscopies were performed for follow-up of PUD.
(11) I can't quite see how we would frame a principle that would include, say, football match tickets but exclude Christmas puddings.
(12) Cut into fat slices for a hearty pudding in the evening and a yet heartier breakfast the morning after.
(13) His quick yorkshire puddings would have my grandmother spinning in her grave.
(14) It is as peaceful as a platypus playing with a potato pudding.” In 2007 Levy published Love and Sex with Robots , a book that one USA Today critic found “troublingly arousing”.
(15) Non-smokers, of both sexes, were significantly more likely than smokers to consume, frequently, fresh fruit in summer and winter, fruit juice, cooked and canned fruit, salads in summer and winter, breakfast cereals, cakes, biscuits, puddings, pasta, poultry, light desserts and preserves.
(16) In resting primary T lymphocytes the interleukin 2 (IL-2) gene is silenced by a repressor binding to the Pud element spanning positions -292 to -264 upstream of the cap site.
(17) None of the PUD patients who had serum PG I levels under this limit relapsed.
(18) The pudding brand Gü has drawn inspiration from David Lynch's cult 1990s series Twin Peaks in an unsettling ad campaign that marks the brand's debut on TV.
(19) Chocolate stout pudding (above) Admittedly, with summer creeping in and temperatures rising, it's hardly pudding season.But I'm a firm believer in the restorative powers of stodge, and I'd hate for the pleasures of pudding – steamed sponges, sticky toffee, spotted dick and custard – to be out of bounds for part of the year.
(20) The relationship of PUD to sex distribution, smoking, alcohol consumption and anti-inflammatory therapy followed expected patterns.
Pued
Definition:
(imp. & p. p.) of Pue
Example Sentences:
(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.