(v. i.) To make a low whistling sound; to chirp, as birds.
Example Sentences:
(1) Before LRLN (base line), increasing treadmill speed for horses from standing to the trot and gallop progressively increased HR, respiratory frequency, VImax, VEmax, PuI, PuE, Hb, and PaCO2 values and decreased PaO2, pH, and HCO3- values; inspiratory and expiratory impedances were unchanged.
(2) Minute volume decreased at exercise after LRLN, but the changes were not significant; LRLN had no effect on VEmax, PuE, ZE, heart rate, arterial carbon dioxide tension (PaCO2), or VT. Subtotal arytenoidectomy did not improve upper airway flow mechanics or blood gas measurements impaired by laryngeal hemiplegia.
(3) Los otros dos grandes parques de la ciudad, Bosque de Aragón y Bosque de Tlalpan, tienen horarios aún más reducidos, pues diariamente cierran, como más tarde, a las 6pm.
(4) At baseline, increasing treadmill speed progressively increased peak inspiratory and expiratory flow (VImax and VEmax, respectively), peak inspiratory and expiratory transupper airway pressure (PuI and PuE, respectively), respiratory frequency (f), tidal volume (VT), minute volume (VE), and heart rate.
(5) Functional analysis of the deletions in Dictyostelium transformants revealed two short regulatory sequences: a positive upstream element (PUE) between -599 and -572 which increases transcription by a factor of 10 but does not affect the developmental pattern of expression and an upstream activator sequence (UAS) between -249 and -215 which is essential for transcription and proper developmental regulation.
(6) Inspiratory and expiratory transupper airway pressures (PuI, PuE, respectively) were determined as pressure differences between barometric pressure and lateral tracheal pressure.
(7) Entre el 2000 y el 2012, la obesidad en población adulta ha mostrado una constante tendencia a la alta, pues un 16% de la población de la ciudad se vio afectada en el año 2000, un 19% en 2006, y un 26% en 2012.
(8) case of Capillaria hepatica seen in the Mexican Republic is reported together with clinical and laboratory findings of the visceral larva migrans syndrome, diagnosis which was made at the Hospital of Specialties of the Mexican Social Security Institute at Puebla, Pue.
(9) Left recurrent laryngeal neurectomy had no effect on PuE, VEmax, HR, PaO2, pH, Hb, or expiratory impedance values.
(10) After site-directed mutagenesis, the genes coding for the 42- and 51-kilodalton (kDa) mosquitocidal proteins of Bacillus sphaericus 2362 were placed under the regulation of the aprE (subtilisin) promoter of the Bacillus subtilis vector pUE (a derivative of pUB18).
Pued
Definition:
(imp. & p. p.) of Pue
Example Sentences:
(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.