What's the difference between pued and puet?

Pued


Definition:

  • (imp. & p. p.) of Pue

Example Sentences:

  • (1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
  • (2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
  • (3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
  • (4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
  • (5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
  • (6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
  • (7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
  • (8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
  • (9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
  • (10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
  • (11) Inhalation was the primary mode of the Pu exposures.
  • (12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
  • (13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
  • (14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
  • (15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
  • (16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
  • (17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
  • (18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
  • (19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
  • (20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.

Puet


Definition:

  • (n.) The pewit.

Example Sentences:

  • (1) Catalytically active Pneumocystis carinii thymidylate synthase is expressed to the extent of about 4% of the soluble protein in Escherichia coli chi 2913 harboring plasmid pUETS-1.8 (U. Edman, J. C. Edman, B. Lundgren, and D. V. Santi, Proc.

Words possibly related to "pued"

Words possibly related to "puet"