What's the difference between repertitious and repetitious?
Repertitious
Definition:
(a.) Found; gained by finding.
Example Sentences:
Repetitious
Definition:
(a.) Repeating; containing repetition.
Example Sentences:
(1) Such ordering projects involve a large investment of effort involving many repetitious experiments.
(2) The repetitious tet element is itself part of a 7.2 Mdal-transposon, named Tn1721, as demonstrated by the following criteria; (i) Tn1721 has been translocated to phage lambda.
(3) The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T).
(4) Over-all, written repetitiousness was more strongly correlated with psychopathologic features than oral repetitiousness.
(5) Dentists in developed countries tend to provide highly restoration-oriented dental care, yet recent research has shown that restorations have many shortcomings and that a costly and repetitious restorative cycle is easily established.
(6) The program interacts with other software in the hospital, avoiding repetitious entries.
(7) Repetitious DNA fractions were obtained at C0t 0-0.01.
(8) "Extremely severe" and repetitious gross oral movements (around 1 Hz) were observed within a few minutes after injection and continued for up to 1 h. Thereafter, oral movements tended to decrease, and they disappeared completely 3 weeks after injection.
(9) While the method should be applicable to a number of repetitious DNA sequences, we have used the polypyrimidine DNA sequences (TCTCT)n to develop this technique.
(10) A model of 12 laboratory tests was found to be more appropriate for studying recognition and follow-up than one of 30 because of fewer repetitious tests and fewer results of doubtful clinical usefulness.
(11) In contrast to these gene families, sequences complementary to an internally repetitious Echinus DNA clone were found primarily in the methylated DNA compartment.
(12) The sequence that codes for the gly-ala repetitious peptide characteristic of fibroin begins somewhere between 1340 and 1600 bp from the 5' end.
(13) Repetitious sequences are found in DNA components of all base compositions but the (G + C)-rich sequences are enriched for repetitive sequences in (A + T)-rich components are tandemly arranged; those in (G + C)-rich components tend to be interspersed with single copy sequences.
(14) 300-400 bp) contains short direct repeats, otherwise dh is in general internally non-repetitious.
(15) We suppose that the repetitious nonhomologies generate DNA configurations sufficient to disrupt the effective synapsis over the entire locus.
(16) The renaturation kinetics of labeled DNA derived from synchronized Chinese hamster cells indicate that the three classes of repetitious DNA replicate uniformly throughout the S period, and that a piece of repetitious DNA may occur at or near the beginning of each replicon.
(17) Ten length variants were cloned, including alleles at each of the four PRB loci, and in every case the region of length difference was localized to the tandemly repetitious third exon.
(18) The middle repetitious DNA sequences are thought to be related in these two DNA families.
(19) In situ hybridization of BR 2 RNA to the polytene chromosomes of each individual species, as well as their F1 hybrids, reveals that the repetitious BR 2 DNA in the two species has, within the limits of the technique, retained identity of nucleotide sequences and degree of repetition.
(20) Arthroscopy in each case failed to demonstrate the anticipated loose body but did demonstrate a fibrotic synovial fringe that impinged between the radial head and the capitellum on repetitious elbow flexion and extension, particularly with the forearm in pronation.