What's the difference between repetition and repetitious?

Repetition


Definition:

  • (n.) The act of repeating; a doing or saying again; iteration.
  • (n.) Recital from memory; rehearsal.
  • (n.) The act of repeating, singing, or playing, the same piece or part a second time; reiteration of a note.
  • (n.) Reiteration, or repeating the same word, or the same sense in different words, for the purpose of making a deeper impression on the audience.
  • (n.) The measurement of an angle by successive observations with a repeating instrument.

Example Sentences:

  • (1) The results of the evaluation confirm that most problems seen by first level medical personnel in developing countries are simple, repetitive, and treatable at home or by a paramedical worker with a few safe, essential drugs, thus avoiding unnecessary visits to a doctor.
  • (2) This modulation results from repetitive, alternating bursts of excitatory and inhibitory postsynaptic potentials, which are caused at least in part by synaptic feedback to the command neurons from identified classes of neurons in the feeding network.
  • (3) This promotion of repetitive activity by the introduction of additional potassium channels occurred up to an "optimal" value beyond which a further increase in paranodal potassium permeability narrowed the range of currents with a repetitive response.
  • (4) This condition may be caused by the prolonged, repetitive elevations of gonadal steroids and other hormones known to suppress gonadotropin-releasing hormone secretion that are elicited by their daily exercise.
  • (5) Two hours after the administration, the combinations of ethanol plus diazepam and ethanol plus meclophenoxate impaired significantly the number of necessary repetitions.
  • (6) This effect of adrenalectomy on MNE excitability was further demonstrated by recording directly the neostigmine-induced repetitive neural discharges responsible for the muscle fasciculations.
  • (7) The fifth plasmid contains sequences which are repeated in the yeast genome, but it is not known whether any or all of the ribosomal protein gene on this clone contains repetitive DNA.
  • (8) For further education, this would be my priority: a substantial increase in funding and an end to tinkering with the form of qualifications and bland repetition of the “parity of esteem” trope.
  • (9) As the frequency of the stimulus bursts was progressively changed, the sinoatrial (SA) nodal pacemaker cells became synchronized with the repetitive bursts of stimuli over a certain range of burst frequencies.
  • (10) Light-induced cone shortening provides a useful model for stuying nonmuscle contraction because it is linear, slow, and repetitive.
  • (11) The average repetitive yields and initial coupling of proteins spotted or blotted into PVDF membranes ranged between 84-98% and 30-108% respectively, and were comparable with the yields measured for proteins spotted onto Polybrene-coated glass fiber discs.
  • (12) Analytic therapy aims at converting transference as repetition of behaviour into recollection.
  • (13) Effects were monitored electrophysiologically by repetitive nerve stimulation and by standardized clinical testing.
  • (14) Variations in image orientation, repetition time (TR), and flip angle were evaluated to determine their effects on flow-related enhancement.
  • (15) Instead, a repetitive, stepwise dissolution pattern was observed.
  • (16) Studies in cattle assessing changes in number and size of antral follicles, concentrations of estradiol, androgens and progesterone in serum and follicular fluid, and numbers of gonadotropin receptors per follicle during repetitive estrous cycles and postpartum anestrus are reviewed.
  • (17) This decrease was associated with a release of lactate and inorganic phosphate during the repetitive periods of reperfusion.
  • (18) His bundle recordings and premature atrial stimulation from coronary sinus, mid-right atrium and high-right atrium were performed in a patient with repetitive supraventricular tachycardias.
  • (19) The torques, although not large enough to dislodge the socket immediately, are repetitive and so may contribute to loosening.
  • (20) Dissociated culture of adult mouse dorsal root ganglion cells on glass plates, on which grating-associated microstructures (a repetition of microgrooves [mGRV] and microsteps [mSTP] of 0.1-10 micron) are fabricated by the conventional lithographic techniques, represents a remarkable bi-directional growth of their nerve fibers in the axial direction of the grating.

Repetitious


Definition:

  • (a.) Repeating; containing repetition.

Example Sentences:

  • (1) Such ordering projects involve a large investment of effort involving many repetitious experiments.
  • (2) The repetitious tet element is itself part of a 7.2 Mdal-transposon, named Tn1721, as demonstrated by the following criteria; (i) Tn1721 has been translocated to phage lambda.
  • (3) The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T).
  • (4) Over-all, written repetitiousness was more strongly correlated with psychopathologic features than oral repetitiousness.
  • (5) Dentists in developed countries tend to provide highly restoration-oriented dental care, yet recent research has shown that restorations have many shortcomings and that a costly and repetitious restorative cycle is easily established.
  • (6) The program interacts with other software in the hospital, avoiding repetitious entries.
  • (7) Repetitious DNA fractions were obtained at C0t 0-0.01.
  • (8) "Extremely severe" and repetitious gross oral movements (around 1 Hz) were observed within a few minutes after injection and continued for up to 1 h. Thereafter, oral movements tended to decrease, and they disappeared completely 3 weeks after injection.
  • (9) While the method should be applicable to a number of repetitious DNA sequences, we have used the polypyrimidine DNA sequences (TCTCT)n to develop this technique.
  • (10) A model of 12 laboratory tests was found to be more appropriate for studying recognition and follow-up than one of 30 because of fewer repetitious tests and fewer results of doubtful clinical usefulness.
  • (11) In contrast to these gene families, sequences complementary to an internally repetitious Echinus DNA clone were found primarily in the methylated DNA compartment.
  • (12) The sequence that codes for the gly-ala repetitious peptide characteristic of fibroin begins somewhere between 1340 and 1600 bp from the 5' end.
  • (13) Repetitious sequences are found in DNA components of all base compositions but the (G + C)-rich sequences are enriched for repetitive sequences in (A + T)-rich components are tandemly arranged; those in (G + C)-rich components tend to be interspersed with single copy sequences.
  • (14) 300-400 bp) contains short direct repeats, otherwise dh is in general internally non-repetitious.
  • (15) We suppose that the repetitious nonhomologies generate DNA configurations sufficient to disrupt the effective synapsis over the entire locus.
  • (16) The renaturation kinetics of labeled DNA derived from synchronized Chinese hamster cells indicate that the three classes of repetitious DNA replicate uniformly throughout the S period, and that a piece of repetitious DNA may occur at or near the beginning of each replicon.
  • (17) Ten length variants were cloned, including alleles at each of the four PRB loci, and in every case the region of length difference was localized to the tandemly repetitious third exon.
  • (18) The middle repetitious DNA sequences are thought to be related in these two DNA families.
  • (19) In situ hybridization of BR 2 RNA to the polytene chromosomes of each individual species, as well as their F1 hybrids, reveals that the repetitious BR 2 DNA in the two species has, within the limits of the technique, retained identity of nucleotide sequences and degree of repetition.
  • (20) Arthroscopy in each case failed to demonstrate the anticipated loose body but did demonstrate a fibrotic synovial fringe that impinged between the radial head and the capitellum on repetitious elbow flexion and extension, particularly with the forearm in pronation.