(1) They also suggest that test substances can be used for over a year, and that allergy to MDA may point to MDI exposure contained in PU chemicals.
(2) In the present paper, we show that three PU located between co-transcribed genes in E. coli are not a transcription terminator.
(3) Currently one third to over one half of patients presenting with PU perforation are aged over 65, with an increasing percentage of female patients and gastric ulcer perforations.
(4) Image gradient was highest for the wd catheter, followed by the pv and pu catheters, and lowest for the nylon catheter.
(5) During carrier-supported chemical cleavage with dimethylsulfate (DMS) (G), HCOOH (A + G), KMnO4 (T greater than Pu) and NH2OH (C), losses of immobilized DNA are very low.
(6) This decrease is non-random and involves mainly the Pu-m5C-Pu sequences without affecting the long pyrimidine blocks.
(7) After longer incubations (7 to 14 days), some Nocardia colonies were larger on PA, PG and PU than they were on BA.
(8) There is an extensive alternating Pu:Py region including the T-A-T-A box of both promoters and an eight base-pair exact homology; further downstream, there is another 11 base-pair highly conserved sequence which either overlaps or lies in close proximity to the unregulated start sites of URA1 in S. pombe and of URA3 in S. cerevisiae.
(9) This study compares, in 2-d-old rats, the migration rates of epithelial cells on villi of the small intestine, using two labelling methods: a single [3H] thymidine injection; and cytoplasmic labelling by a single ingestion of Pu-citrate.
(10) Estimates of individual Pu depositions, including lung burdens, as of 1987 or at time of death range from 52 to 3180 Bq (1.4 to 86 nCi) with a median value of 500 Bq (13.5 nCi).
(11) Inhalation was the primary mode of the Pu exposures.
(12) Human leukocyte antigens (HLA) were investigated in 200 healthy Taiwan inhabitants of Taiwanese (46 persons), Hakka (36), Tai-Ya Tribe (28) Pu-Long Tribe (30) Pai-Wan Tribe (30) and Lu-kai (30) descent.
(13) Since all of the mutations that were mapped affect the eye pigmentation function of Pu, and since this function is the best defined biochemically, we have concentrated on identifying and characterizing Pu products required for eye pigmentation in our initial examination of the cloned region.
(14) The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem.
(15) In the rats, Pu was retained in the epithelial cells on villi, but in the guinea pigs and primates it was confined to the macrophages under the epithelial cells in the lacteal region.
(16) Sulfonated PU-PEO exhibited a lower degree of adhesion and shape change of platelet.
(17) On the basis of the endoscopic diagnosis only, the isolation rates of the organisms in normal, gastritis or gastroduodenitis (GD), and peptic ulcer (PU) disease patients, were not significantly different among the 89 patients evaluated.
(18) However, after sloughing of labelled cells in the intestinal lumen, Pu was reabsorbed by the distal epithelial cells.
(19) The present experiment was conducted using male Fischer rats with a heterotopically transplanted urinary bladder (HTB) to determine whether the effects of DFMO are prevented by exogeneous Pu.
(20) In order to evaluate a new valve design made by dipmolding with different PU materials, an animal test series was carried out in which two valves from each material were implanted into the mitral position of growing Jersey calves.
Sued
Definition:
(imp. & p. p.) of Sue
Example Sentences:
(1) Villagers, including one man who has been left disabled and the relatives of six men who were killed, are suing ABG in the UK high court, represented by British law firm Leigh Day, alleging that Tanzanian police officers shot unarmed locals.
(2) "This is the third event in the last few days following An-26 and SU-25 planes being brought down.
(3) In a climate in which medical staffs are being sued as a result of their decisions in peer review activities, hospitals' administrative and medical staffs are becoming more cautious in their approach to medical staff privileging.
(4) The spontaneous v alleles that are suppressed by the suppressor of sable [su(s)] are apparently identical insertions of 412, a copia-like transposable element.
(5) A coalition of plaintiffs suing Texas – which includes minority rights groups, voters and Democratic lawmakers – say their experts have estimated 787,000 registered voters lacking one of seven acceptable forms of ID.
(6) This strain does not suppress phage phi 29 mutant susB47, selected on a B. subtilis strain containing the su+3 suppressor isolated by Georgopoulos.
(7) Even as those words were being published, lawyers and senior executives from News International's subsidiary News Group were preparing to run to court to gag Gordon Taylor, the chief executive of the Professional Footballers' Association, who was suing the News of the World for its undisclosed involvement in the illegal interception of messages left on his mobile phone.
(8) Su(H) is also involved in controlling the fates of sensillum accessory cells and is specifically expressed in two of these cells.
(9) But we shouldn’t forget that Gawker was not just getting sued over the Hulk Hogan sex tape case.
(10) Raji consistently exhibited the highest and SU-AMB-1 the lowest polymerase activity and ellipticity.
(11) Doctors fear being sued if morphine given to relieve terminally ill patients' pain hastens their death.
(12) In American football, however, more than 4,500 former NFL players sued their league for downplaying the dangers of concussion, and last year there was an out-of-court settlement for around £500m.
(13) In 2009, the Office of Fair Trading successfully sued Foxtons for extracting “unfair” charges from landlords.
(14) Last Friday, a high court judge ordered NoW to make available Mulcaire's notes to the growing list of people suing the paper.
(15) A prominent Mexican journalist and her publisher, Penguin Random House Grupo Editorial, are being sued in an attempt to force them to remove a bombshell political investigation from the country’s bookstores.
(16) The only fact the Guardian can report is that the case involves the London solicitors Carter-Ruck, who specialise in suing the media for clients, who include individuals or global corporations.
(17) The segment of DNA encoding only this 5-kb message rescues both the suppression and cold-sensitive male sterility phenotypes of su(s).
(18) IBAT weights, IBAT:BW ratios, and IBAT cell number of corpulent greater than lean, and were greater than with SU than CS diet in both phenotypes.
(19) Enraged that this had happened when casting had barely commenced, the director shut down the movie unilaterally (perhaps finally ...) and sued Gawker .
(20) McKillen, who owns 36% of Maybourne Hotel Group, is suing the Barclay brothers, alleging they used illegal means to seize control of the company.